IthaID: 278

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	Poly A (-AATAA)	HGVS Name:	HBB:c.110_114del
Hb Name:	N/A	Protein Info:	N/A

Context nucleotide sequence:
GGGCCTTGAGCATCTGGATTCTGCCTAA [-/TAAAA] AACATTTATTTTCATTGCAATGATGT (Strand: -)

Also known as: polyA (-TAAAA)

Comments: A 5 bp deletion of the polyA signal sequence (AATAAA>A). Found in a homozygous state in an Arab child from Gaza and in a proband from Egypt, both with transfusion-dependent β-thalassaemia major. Found as a compound heterozygote with Hb S in a proband from Nigeria.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	dbSNP
ClinVar

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	β-thalassaemia
Allele Phenotype:	β+
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	72128
Size:	5 bp
Located at:	β
Specific Location:	3'UTR, Poly(A)

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	RNA cleavage - Poly(A) signal (mRNA Processing)
Ethnic Origin:	Arab/Palestinian, Egyptian, Nigerian
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

Rund D, Dowling C, Najjar K, Rachmilewitz EA, Kazazian HH, Oppenheim A, Two mutations in the beta-globin polyadenylylation signal reveal extended transcripts and new RNA polyadenylylation sites., Proceedings of the National Academy of Sciences of the United States of America, 89(10), 4324-8, 1992 PubMed
el-Kalla S, Mathews AR, A significant beta-thalassemia heterogeneity in the United Arab Emirates., Hemoglobin, 21(3), 237-47, 1997 PubMed
Lacan P, Ponceau B, Aubry M, Francina A, Mild Hb S-beta(+)-thalassemia with a deletion of five nucleotides at the polyadenylation site of the beta-globin gene., Hemoglobin, 27(4), 257-9, 2003 PubMed

Created on 2010-06-16 16:13:15, Last reviewed on 2020-10-02 10:21:09 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:15	The IthaGenes Curation Team	Created
2	2013-10-15 17:28:32	The IthaGenes Curation Team	Reviewed.
3	2014-06-04 12:14:21	The IthaGenes Curation Team	Reviewed. Variation size corrected. HbVar link added.
4	2019-11-06 17:04:24	The IthaGenes Curation Team	Reviewed. Common name and Ethnicity corrected. HbVar link removed. Comment added.
5	2019-11-06 17:06:57	The IthaGenes Curation Team	Reviewed. dbSNP link added.
6	2019-11-14 08:00:02	The IthaGenes Curation Team	Reviewed. HGVS name and Location corrected. Comment added.
7	2019-11-14 08:06:26	The IthaGenes Curation Team	Reviewed. Synonyn name, Allele and Context sequence, Ethnic origin and Reference added.
8	2020-10-02 10:21:09	The IthaGenes Curation Team	Reviewed. Name edits

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.