IthaID: 2777

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs776717 HGVS Name: NC_000015.10:g.42109454T>C

Context nucleotide sequence:
ctttgaatttttgatttgcttttct [A/G] GGGAGATTTTCTCAACTCTATTATC (Strand: -)

Also known as:

Comments: SNP associated with elevated HbF in African Americans with sickle cell disease, recruited from the Cooperative Study of Sickle Cell Disease (CSSCD), the Comprehensive Sickle Cell Centers Collaborative Data (CDATA) study and the Thomas Jefferson University (n=244).

External Links


Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]


Chromosome: 15
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: PLA2G4D-PLA2G4F
Specific Location: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Liu L, Pertsemlidis A, Ding LH, Story MD, Steinberg MH, Sebastiani P, Hoppe C, Ballas SK, Pace BS, A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease., Exp. Biol. Med. (Maywood) , 2016 PubMed
Created on 2016-05-16 13:10:10, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.