IthaID: 2771



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs267192 HGVS Name: NC_000006.12:g.7845011C>T

Context nucleotide sequence:
GCCAGCCAGTGGTCTGTTCACTACC [C/T] GATCCCCGTAGTAAGCCGTGGGTAA (Strand: +)

Comments: SNP associated with pulmonary hypertension risk in individuals with sickle cell disease acquired from outpatient clinics at the Duke University Medical Center and the University of North Carolina Chapel Hill (n=581).

External Links

Location

Chromosome: 6
Locus: N/A
Locus Location: N/A
Size: 1 bp
Located at: BMP6
Specific Location: Intron 1

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pulmonary arterial hypertension [HP:0002092] [OMIM:265400]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Ashley-Koch AE, Elliott L, Kail ME, De Castro LM, Jonassaint J, Jackson TL, Price J, Ataga KI, Levesque MC, Weinberg JB, Orringer EP, Collins A, Vance JM, Telen MJ, Identification of genetic polymorphisms associated with risk for pulmonary hypertension in sickle cell disease., Blood , 111(12), 5721-6, 2008 PubMed
Created on 2016-05-16 11:15:20, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.