IthaID: 277
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | Poly A (-TA); (AATAAA>AAAA) | HGVS Name: | HBB:c.*110_*111delTA |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
GGCCTTGAGCATCTGGATTCTGCCTAA [-/TA] AAAAACATTTATTTTCATTGCAAT (Strand: -)
Also known as:
Comments: Found in a French β-thalassaemic patient originating from Normandy. Found in an African American presenting with typical β-thal trait.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | β+ |
| Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972] |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72128 |
| Size: | 2 bp |
| Located at: | β |
| Specific Location: | 3'UTR, Poly(A) |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | RNA cleavage - Poly(A) signal (mRNA Processing) |
| Ethnic Origin: | French, African-American |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | No |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Ghanem N, Girodon E, Vidaud M, Martin J, Fanen P, Plassa F, Goossens M, A comprehensive scanning method for rapid detection of beta-globin gene mutations and polymorphisms., Human mutation, 1(3), 229-39, 1992 PubMed
- Kimberland ML, Boehm CD, Kazazian HH, Two novel beta-thalassemia alleles: poly A signal (AATAAA-->AAAA) and -92 C-->T., Human mutation, 5(3), 275-6, 1995 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2020-10-02 10:20:52 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-06-04 12:16:44 | The IthaGenes Curation Team | Reviewed. Variation size corrected. HbVar link added. |
| 4 | 2019-11-04 14:07:31 | The IthaGenes Curation Team | Reviewed. Common name edited. |
| 5 | 2019-11-22 11:34:06 | The IthaGenes Curation Team | Reviewed. HGVS name and Location corrected. Allele, Context sequence, Comment and dbSNP links added. |
| 6 | 2019-11-22 11:37:39 | The IthaGenes Curation Team | Reviewed. Reference added. |
| 7 | 2020-10-02 10:20:52 | The IthaGenes Curation Team | Reviewed. Names edits. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07