IthaID: 2754

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs11853426	HGVS Name:	NC_000015.10:g.60317231C>T

Context nucleotide sequence:
CTGGGGCATGTCCACCCACCTATGA [C/T] GTAGGTAAATGAGTACCTAGAGCAG (Strand: +)

Also known as: hCV26910500

Comments: SNP associated with osteonecrosis in the Cooperative Study of Sickle Cell Disease (CSSCD) (442 cases; 455 controls) [PMID: 15784727]. SNP associated with risk of stroke in the CSSCD (92 cases; 1306 controls) [PMID: 15778708], but the association was not replicated in an independent sample of pediatric sickle cell disease patients acquired from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study) [PMID: 21515823].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805] Stroke [HP:0001297] [OMIM:601367]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	15
Locus:	N/A
Locus Location:	N/A
Size:	1 bp
Located at:	ANXA2
Specific Location:	N/A

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	African American
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Baldwin C, Nolan VG, Wyszynski DF, Ma QL, Sebastiani P, Embury SH, Bisbee A, Farrell J, Farrer L, Steinberg MH, Association of klotho, bone morphogenic protein 6, and annexin A2 polymorphisms with sickle cell osteonecrosis., Blood , 106(1), 372-5, 2005 PubMed
Sebastiani P, Ramoni MF, Nolan V, Baldwin CT, Steinberg MH, Genetic dissection and prognostic modeling of overt stroke in sickle cell anemia., Nat. Genet. , 37(4), 435-40, 2005 PubMed
Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011 PubMed

Created on 2016-05-15 17:27:14, Last reviewed on (Show full history)

A/A	Date	Curator(s)	Comments
1	2016-05-15 17:27:14	The IthaGenes Curation Team	Created

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.