IthaID: 2754
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs11853426 | HGVS Name: | NC_000015.10:g.60317231C>T |
Context nucleotide sequence:
CTGGGGCATGTCCACCCACCTATGA [C/T] GTAGGTAAATGAGTACCTAGAGCAG (Strand: +)
Also known as: hCV26910500
Comments: SNP associated with osteonecrosis in the Cooperative Study of Sickle Cell Disease (CSSCD) (442 cases; 455 controls) [PMID: 15784727]. SNP associated with risk of stroke in the CSSCD (92 cases; 1306 controls) [PMID: 15778708], but the association was not replicated in an independent sample of pediatric sickle cell disease patients acquired from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study) [PMID: 21515823].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805] Stroke [HP:0001297] [OMIM:601367] |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Baldwin C, Nolan VG, Wyszynski DF, Ma QL, Sebastiani P, Embury SH, Bisbee A, Farrell J, Farrer L, Steinberg MH, Association of klotho, bone morphogenic protein 6, and annexin A2 polymorphisms with sickle cell osteonecrosis., Blood , 106(1), 372-5, 2005 PubMed
- Sebastiani P, Ramoni MF, Nolan V, Baldwin CT, Steinberg MH, Genetic dissection and prognostic modeling of overt stroke in sickle cell anemia., Nat. Genet. , 37(4), 435-40, 2005 PubMed
- Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011 PubMed
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-15 17:27:14 | The IthaGenes Curation Team | Created |