IthaID: 2718



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs7130110 HGVS Name: NG_000007.3:g.22742C>G

Context nucleotide sequence:
CCAGTTATGCCACACTTTCCTACAT [C/G] ATGGGCACTGAAGGTTAAAACTTGA (Strand: +)

Comments: SNP associated with HbF levels in the Cooperative Study of Sickle Cell Disease (CSSCD) (≥24 years, n=538; <24 years, n=980). Associated with the HbF response to hydroxyurea in pediatric patients with sickle cell disease.

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 22742
Size: 1 bp
Located at: ε
Specific Location: N/A

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]
Hb F response to hydroxyurea

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American, Hispanic
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Sebastiani P, Wang L, Nolan VG, Melista E, Ma Q, Baldwin CT, Steinberg MH, Fetal hemoglobin in sickle cell anemia: Bayesian modeling of genetic associations., Am. J. Hematol. , 83(3), 189-95, 2008 PubMed
  2. Ware RE, Despotovic JM, Mortier NA, Flanagan JM, He J, Smeltzer MP, Kimble AC, Aygun B, Wu S, Howard T, Sparreboom A, Pharmacokinetics, pharmacodynamics, and pharmacogenetics of hydroxyurea treatment for children with sickle cell anemia., Blood , 118(18), 4985-91, 2011 PubMed
  3. Green NS, Ender KL, Pashankar F, Driscoll C, Giardina PJ, Mullen CA, Clark LN, Manwani D, Crotty J, Kisselev S, Neville KA, Hoppe C, Barral S, Candidate sequence variants and fetal hemoglobin in children with sickle cell disease treated with hydroxyurea., PLoS ONE , 8(2), e55709, 2013 PubMed
Created on 2016-05-13 09:47:57, Last reviewed on 2016-05-25 11:27:24 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.