IthaID: 2688



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs7300155 HGVS Name: NG_042166.1:g.25282C>T

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TAGTCAGGCTAGCTCCCTTCCCCCA [A/G] TCCCTGCCCCACCATACACAGAACA (Strand: +)

Comments: SNP (GG genotype) associated with elevated red blood cell adhesion to laminin in individuals with sickle cell disease (SCD) acquired from the Sickle cell Centre of the Duke University. Red cell adhesion is thought to contribute to the vaso-occlusive process in SCD.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: RBC adhesion

Location

Chromosome: 12
Locus: NG_042166.1
Locus Location: 25282
Size: 1 bp
Located at: ADCY6
Specific Location: Intron 20

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: N/A
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Eyler CE, Jackson T, Elliott LE, De Castro LM, Jonassaint J, Ashley-Koch A, Telen MJ, beta(2)-Adrenergic receptor and adenylate cyclase gene polymorphisms affect sickle red cell adhesion., Br. J. Haematol. , 141(1), 105-8, 2008 PubMed
Created on 2016-05-12 10:01:13, Last reviewed on 2019-07-02 22:22:59 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.