IthaID: 2687
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs3730070 | HGVS Name: | NG_042166.1:g.19032C>G |
Context nucleotide sequence:
AGGGCCCAGCACTCAGCTCAGCCTC [C/G] TCTCCCTCAGTACTCCCGGAAGGTG (Strand: -)
Also known as:
Comments: SNP (GG genotype) associated with elevated red blood cell adhesion to laminin in individuals with sickle cell disease (SCD) acquired from the Sickle cell Centre of the Duke University. Red cell adhesion is thought to contribute to the vaso-occlusive process in SCD [PMID: 18324973]. The rs3730070-G allele associated with lower haemolytic rate in SCD patients from Guadeloupe [PMID: 27067484].
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Haemolytic anaemia [HP:0001878] RBC adhesion |
Location
Chromosome: | 12 |
---|---|
Locus: | NG_042166.1 |
Locus Location: | 19032 |
Size: | 1 bp |
Located at: | ADCY6 |
Specific Location: | Intron |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Guadeloupeans |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Eyler CE, Jackson T, Elliott LE, De Castro LM, Jonassaint J, Ashley-Koch A, Telen MJ, beta(2)-Adrenergic receptor and adenylate cyclase gene polymorphisms affect sickle red cell adhesion., Br. J. Haematol. , 141(1), 105-8, 2008 PubMed
- Cita KC, Ferdinand S, Connes P, Brudey L, Tressières B, Etienne-Julan M, Lemonne N, Tarer V, Elion J, Romana M, Association of adenylyl cyclase 6 rs3730070 polymorphism and hemolytic level in patients with sickle cell anemia., Blood Cells Mol. Dis. , 58(0), 21-5, 2016 PubMed
Created on 2016-05-12 09:56:49,
Last reviewed on 2017-10-16 17:20:46 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-12 09:56:49 | The IthaGenes Curation Team | Created |
2 | 2016-05-12 09:58:04 | The IthaGenes Curation Team | Reviewed. |
3 | 2016-05-25 17:05:11 | The IthaGenes Curation Team | Reviewed. |
4 | 2016-09-29 14:25:08 | The IthaGenes Curation Team | Reviewed. Mutation comment section updated. Other details section updated. Reference added. |
5 | 2017-10-16 17:20:46 | The IthaGenes Curation Team | Reviewed. Mutation comment and Clinical phenotype sections edited. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2022-06-24 13:54:27