IthaID: 2683



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs449853 HGVS Name: NC_000006.12:g.7872119C>T

Context nucleotide sequence:
AGAGAGGTAACACAGCTTTGCCCCA [A/G] TGGATTCACCAGTCAAGGGCAGGGC (Strand: -)

Comments: SNP associated with osteonecrosis (442 cases; 455 controls) and bacteraemia (145 cases; 1248 controls) in the Cooperative Study of Sickle Cell Disease (CSSCD). SNP associated with risk of stroke in the CSSCD (92 cases; 1306 controls) [PMID: 15778708], but the association was not replicated in an independent sample of pediatric sickle cell disease patients acquired from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study) [PMID: 21515823].

External Links

Location

Chromosome: 6
Locus: NG_012002.1
Locus Location: N/A
Size: 1 bp
Located at: BMP6
Specific Location: Intron 4

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805]
Stroke [HP:0001297] [OMIM:601367]
Bacteremia [HP:0031864]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Baldwin C, Nolan VG, Wyszynski DF, Ma QL, Sebastiani P, Embury SH, Bisbee A, Farrell J, Farrer L, Steinberg MH, Association of klotho, bone morphogenic protein 6, and annexin A2 polymorphisms with sickle cell osteonecrosis., Blood , 106(1), 372-5, 2005 PubMed
  2. Sebastiani P, Ramoni MF, Nolan V, Baldwin CT, Steinberg MH, Genetic dissection and prognostic modeling of overt stroke in sickle cell anemia., Nat. Genet. , 37(4), 435-40, 2005 PubMed
  3. Adewoye AH, Nolan VG, Ma Q, Baldwin C, Wyszynski DF, Farrell JJ, Farrer LA, Steinberg MH, Association of polymorphisms of IGF1R and genes in the transforming growth factor- beta /bone morphogenetic protein pathway with bacteremia in sickle cell anemia., Clin. Infect. Dis. , 43(5), 593-8, 2006 PubMed
  4. Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011 PubMed
Created on 2016-05-11 17:47:53, Last reviewed on 2019-07-03 14:43:43 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.