IthaID: 2680



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs270387 HGVS Name: NC_000006.12:g.7772759A>G

Context nucleotide sequence:
CCCCTGGACACCGCTTGGGGAGAAC [A/G] TGTCCTGTCTTTGTCTCTGGACCCT (Strand: +)

Comments: SNP associated with bacteraemia in the Cooperative Study of Sickle Cell Disease (CSSCD) (145 cases; 1248 controls).

External Links

Location

Chromosome: 6
Locus: NG_012002.1
Locus Location: N/A
Size: 1 bp
Located at: BMP6
Specific Location: Intron 1

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Bacteremia [HP:0031864]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Adewoye AH, Nolan VG, Ma Q, Baldwin C, Wyszynski DF, Farrell JJ, Farrer LA, Steinberg MH, Association of polymorphisms of IGF1R and genes in the transforming growth factor- beta /bone morphogenetic protein pathway with bacteremia in sickle cell anemia., Clin. Infect. Dis. , 43(5), 593-8, 2006 PubMed
Created on 2016-05-11 17:26:59, Last reviewed on 2019-07-03 14:40:05 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.