IthaID: 2672

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs7147286 HGVS Name: NG_008647.1:g.15878C>T

Context nucleotide sequence:
ggccctaaaccacaagagtagtgac [A/G] ttggcaattcagttatgccaaagag (Strand: +)

Also known as:

Comments: SNP associated with severe pain crises in individuals with sickle cell disease (SCD) acquired from the Bethesda Sickle Cell Cohort Study at NIH (155 cases;73 controls).

External Links


Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Pain [HP:0012531]


Chromosome: 14
Locus: NG_008647.1
Locus Location: 15878
Size: 1 bp
Located at: GCH1
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African, African American, Caribbean
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Belfer I, Youngblood V, Darbari DS, Wang Z, Diaw L, Freeman L, Desai K, Dizon M, Allen D, Cunnington C, Channon KM, Milton J, Hartley SW, Nolan V, Kato GJ, Steinberg MH, Goldman D, Taylor JG, A GCH1 haplotype confers sex-specific susceptibility to pain crises and altered endothelial function in adults with sickle cell anemia., Am. J. Hematol. , 89(2), 187-93, 2014 PubMed
Created on 2016-05-11 11:55:34, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.