IthaID: 2671
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs1801106 | HGVS Name: | NG_008330.1:g.78602G>A |
Context nucleotide sequence:
AAGAGTCTACCTGTTTACTATCAAA [A/G] AGGTAAAAAAAAAAAAATAAACTAA (Strand: +)
Also known as: HPA-5
Comments: The HPA-5b allele associated with vaso-occlusive crisis in Bahraini-Arabs with SCA (127 VOC, 130 steady-state) [PMID: 19702628] and in Brazilians of African descent with SCA (34 VOC, 63 steady-state) [PMID: 15355504].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Vaso-occlusive crisis |
Location
| Chromosome: | 5 |
|---|---|
| Locus: | NG_008330.1 |
| Locus Location: | 78602 |
| Size: | 1 bp |
| Located at: | ITGA2 |
| Specific Location: | Exon 13 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | Bahraini Arab, African |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Castro V, Alberto FL, Costa RN, Lepikson-Neto J, Gualandro SF, Figueiredo MS, Annichino-Bizzacchi JM, Saad ST, Costa FF, Polymorphism of the human platelet antigen-5 system is a risk factor for occlusive vascular complications in patients with sickle cell anemia., Vox Sang. , 87(2), 118-23, 2004 PubMed
- Al-Subaie AM, Fawaz NA, Mahdi N, Al-Absi IK, Al-Ola K, Ameen G, Almawi WY, Human platelet alloantigens (HPA) 1, HPA2, HPA3, HPA4, and HPA5 polymorphisms in sickle cell anemia patients with vaso-occlusive crisis., Eur. J. Haematol. , 83(6), 579-85, 2009 PubMed
Created on 2016-05-11 11:32:54,
Last reviewed on 2020-03-26 15:54:16 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2016-05-11 11:32:54 | The IthaGenes Curation Team | Created |
| 2 | 2020-03-26 15:53:27 | The IthaGenes Curation Team | Reviewed. Reference, Synonym name and Ethnic origin added. Comment updated. |
| 3 | 2020-03-26 15:54:16 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07