IthaID: 2671



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1801106 HGVS Name: NG_008330.1:g.78602G>A

Context nucleotide sequence:
AAGAGTCTACCTGTTTACTATCAAA [A/G] AGGTAAAAAAAAAAAAATAAACTAA (Strand: +)

Also known as: HPA-5

Comments: The HPA-5b allele associated with vaso-occlusive crisis in Bahraini-Arabs with SCA (127 VOC, 130 steady-state) [PMID: 19702628] and in Brazilians of African descent with SCA (34 VOC, 63 steady-state) [PMID: 15355504].

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Vaso-occlusive crisis

Location

Chromosome: 5
Locus: NG_008330.1
Locus Location: 78602
Size: 1 bp
Located at: ITGA2
Specific Location: Exon 13

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Bahraini Arab, African
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Castro V, Alberto FL, Costa RN, Lepikson-Neto J, Gualandro SF, Figueiredo MS, Annichino-Bizzacchi JM, Saad ST, Costa FF, Polymorphism of the human platelet antigen-5 system is a risk factor for occlusive vascular complications in patients with sickle cell anemia., Vox Sang. , 87(2), 118-23, 2004 PubMed
  2. Al-Subaie AM, Fawaz NA, Mahdi N, Al-Absi IK, Al-Ola K, Ameen G, Almawi WY, Human platelet alloantigens (HPA) 1, HPA2, HPA3, HPA4, and HPA5 polymorphisms in sickle cell anemia patients with vaso-occlusive crisis., Eur. J. Haematol. , 83(6), 579-85, 2009 PubMed
Created on 2016-05-11 11:32:54, Last reviewed on 2020-03-26 15:54:16 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.