IthaID: 2668

Context nucleotide sequence:
GAGGCAATAGGTTTTGAGGGGCATG [A/G] GGACGGGGTTCAGCCTCCAGGGTCC (Strand: +)

Also known as: –308G>A

Comments: The TNF (-308)A variant associated with protection from stroke (large vessel subtype) in pediatric sickle cell disease (SCD) patients acquired from the Cooperative Study of Sickle Cell Disease (CSSCD) (n=230) [PMID: 14615367]. The association was replicated in an independent pediatric sample with SCD, acquired from the multicenter Stroke Prevention Trial in Sickle Cell Anemia (STOP) (45 cases; 45 controls) [PMID: 17600229] but not in a sample acquired from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study) [PMID: 21515823]. This variant also associated with a low serum ferritin concentration in the African American population [PMID: 27332551]. The TNF (-308)G allele was prevalent among Brazilian patients with sickle cell disease (n=240) [PMID: 24391023]. SNP (allele A) associated with an increased risk of acute cerebral ischemia in a pediatric Brazilian cohort with SCA (n=395) [PMID: 27520094].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Heterozygous records (preview in IthaPhen)

1. Hoppe C, Klitz W, Cheng S, Apple R, Steiner L, Robles L, Girard T, Vichinsky E, Styles L, , Gene interactions and stroke risk in children with sickle cell anemia., Blood , 103(6), 2391-6, 2004 PubMed
2. Hoppe C, Klitz W, D'Harlingue K, Cheng S, Grow M, Steiner L, Noble J, Adams R, Styles L, , Confirmation of an association between the TNF(-308) promoter polymorphism and stroke risk in children with sickle cell anemia., Stroke , 38(8), 2241-6, 2007 PubMed
3. Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011 PubMed
4. Torres LS, Belini Júnior E, Silva DG, Lobo CL, Ruiz MA, Bonini-Domingos CR, Frequencies of -308G/A (TNFA) and -509C/T (TGFB1) polymorphisms in sickle cell anemia patients from Brazil., Genet. Mol. Res. , 12(4), 6762-6, 2013 PubMed
5. Gichohi-Wainaina WN, Tanaka T, Towers GW, Verhoef H, Veenemans J, Talsma EF, Harryvan J, Boekschoten MV, Feskens EJ, Melse-Boonstra A, Associations between Common Variants in Iron-Related Genes with Haematological Traits in Populations of African Ancestry., PLoS ONE , 11(6), e0157996, 2016 PubMed
6. Belisário AR, Sales RR, Toledo NE, Muniz MB, Velloso-Rodrigues C, Silva CM, Viana MB, Reticulocyte count is the most important predictor of acute cerebral ischemia and high-risk transcranial Doppler in a newborn cohort of 395 children with sickle cell anemia., Ann. Hematol. , 95(11), 1869-80, 2016 PubMed