IthaID: 2667



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs3783613 HGVS Name: NG_023034.2:g.16491G>C

Context nucleotide sequence:
AGAGATCCAGAAATCGAGATGAGTG [A/C/G] TGGCCTCGTGAATGGGAGCTCTGTC (Strand: +)

Protein sequence:
MPGKMVVILGASNILWIMFAASQAFKIETTPESRYLAQIGDSVSLTCSTTGCESPFFSWRTQIDSPLNGKVTNEGTTSTLTMNPVSFGNEHSYLCTATCESRKLEKGIQVEIYSFPKDPEIHLSGPLEAGKPITVKCSVADVYPFDRLEIDLLKGDHLMKSQEFLEDADRKSLETKSLEVTFTPVIEDIGKVLVCRAKLHIDEMDSVPTVRQAVKELQVYISPKNTVISVNPSTKLQEGGSVTMTCSSEGLPAPEIFWSKKLDNGNLQHLSGNATLTLIAMRMEDSGIYVCEGVNLIGKNRKEVELIVQEKPFTVEISPGPRIAAQIGDSVMLTCSVMGCESPSFSWRTQIDSPLSGKVRSEGTNSTLTLSPVSFENEHSYLCTVTCGHKKLEKGIQVELYSFPRDPEIEMSAGLVNGSSVTVSCKVPSVYPLDRLEIELLKGETILENIEFLEDTDMKSLENKSLEMTFIPTIEDTGKALVCQAKLHIDDMEFEPKQRQSTQTLYVNVAPRDTTVLVSPSSILEEGSSVNMTCLSQGFPAPKILWSRQLPNGELQPLSENATLTLISTKMEDSGVYLCEGINQAGRSRKEVELIIQVTPKDIKLTAFPSESVKEGDTVIISCTCGNVPETWIILKKKAETGDTVLKSIDGAYTIRKAQLKDAGVYECESKNKVGSQLRSLTLDVQGRENNKDYFSPELLVLYFASSLIIPAIGMIIYFARKANMKGSYSLVEAQKSKV

Also known as: G1238C

Comments: SNP associated with stroke risk in individuals with sickle cell disease acquired from the Sickle Cell Clinic of the University Hospital of the West Indies, Jamaica (51 cases; 51 controls).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Stroke [HP:0001297] [OMIM:601367]

Location

Chromosome: 1
Locus: NG_023034.2
Locus Location: 16491
Size: 1 bp
Located at: VCAM1
Specific Location: Exon 6

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Jamaican
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Taylor JG, Tang DC, Savage SA, Leitman SF, Heller SI, Serjeant GR, Rodgers GP, Chanock SJ, Variants in the VCAM1 gene and risk for symptomatic stroke in sickle cell disease., Blood , 100(13), 4303-9, 2002 PubMed
Created on 2016-05-11 10:29:29, Last reviewed on 2016-05-25 09:37:05 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.