IthaID: 2666

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs3025058	HGVS Name:	NG_012100.1:g.3394_3395insT

Context nucleotide sequence:
TCCATTCCTTTGATGGGGGGAAAAA [-/A] CCATGTCTTGTCCTGATTGAAATAC (Strand: +)

Also known as: MMP3 -1171insA , -1171 5A/6A MMP-3

Comments: This polymorphism is an insertion/deletion of a single adenosine (5A/6A) at position -1171 of the MMP3 promoter, with an effect on the level of gene transcription. It associated with stroke risk in pediatric sickle cell disease (SCD) patients acquired from the multicenter Stroke Prevention Trial in Sickle Cell Anemia (STOP) (49 cases, 49 controls) [PMID: 17600229]. The association was not replicated in an independent study, which enrolled pediatric SCD patients from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study) [PMID: 21515823].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Stroke [HP:0001297] [OMIM:601367]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_012100.1
Locus Location:	3394
Size:	1 bp
Located at:	MMP3
Specific Location:	Promoter

Other details

Type of Mutation:	Point-Mutation(Insertion)
Effect on Gene/Protein Function:	Promoter (Transcription)
Ethnic Origin:	African American
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Hoppe C, Klitz W, D'Harlingue K, Cheng S, Grow M, Steiner L, Noble J, Adams R, Styles L, , Confirmation of an association between the TNF(-308) promoter polymorphism and stroke risk in children with sickle cell anemia., Stroke , 38(8), 2241-6, 2007 PubMed
Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011 PubMed

Created on 2016-05-11 10:13:01, Last reviewed on (Show full history)

A/A	Date	Curator(s)	Comments
1	2016-05-11 10:13:01	The IthaGenes Curation Team	Created

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.