IthaID: 2652

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs489347	HGVS Name:	NG_011828.1:g.83070C>G

Context nucleotide sequence:
ACAGCAAAGAGACAGCAGTGACTTA [C/G] GACTGGAGAAGCTTCTACACATTGA (Strand: -)

Also known as:

Comments: SNP associated with risk of stroke in the Cooperative Study of Sickle Cell Disease (CSSCD) (92 cases; 1306 controls). The association was replicated in an independent sample of pediatric SCD patients acquired from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study). SNP (allele C) associated with an increased risk of acute cerebral ischemia (n=395) and of high-risk transcranial Doppler (n=338) in a pediatric Brazilian cohort with SCD.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Stroke [HP:0001297] [OMIM:601367]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	9
Locus:	NG_011828.1
Locus Location:	83070
Size:	1 bp
Located at:	TEK
Specific Location:	Intron

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	African American \| Brazilian
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011 PubMed
Belisário AR, Sales RR, Toledo NE, Muniz MB, Velloso-Rodrigues C, Silva CM, Viana MB, Reticulocyte count is the most important predictor of acute cerebral ischemia and high-risk transcranial Doppler in a newborn cohort of 395 children with sickle cell anemia., Ann. Hematol. , 95(11), 1869-80, 2016 PubMed

Created on 2016-05-10 18:34:03, Last reviewed on 2018-08-13 18:18:28 (Show full history)

A/A	Date	Curator(s)	Comments
1	2016-05-10 18:34:03	The IthaGenes Curation Team	Created
2	2018-08-13 18:18:28	The IthaGenes Curation Team	Reviewed. Mutation comment, Ethnic origin, and Reference added.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.