IthaID: 2652
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs489347 | HGVS Name: | NG_011828.1:g.83070C>G |
Context nucleotide sequence:
ACAGCAAAGAGACAGCAGTGACTTA [C/G] GACTGGAGAAGCTTCTACACATTGA (Strand: -)
Also known as:
Comments: SNP associated with risk of stroke in the Cooperative Study of Sickle Cell Disease (CSSCD) (92 cases; 1306 controls). The association was replicated in an independent sample of pediatric SCD patients acquired from the Stroke With Transfusion Changing to Hydrxyurea (SWiTCH) trial (130 cases; 103 controls enrolled from the HUSTLE study). SNP (allele C) associated with an increased risk of acute cerebral ischemia (n=395) and of high-risk transcranial Doppler (n=338) in a pediatric Brazilian cohort with SCD.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | Stroke [HP:0001297] [OMIM:601367] |
Location
Chromosome: | 9 |
---|---|
Locus: | NG_011828.1 |
Locus Location: | 83070 |
Size: | 1 bp |
Located at: | TEK |
Specific Location: | Intron |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American | Brazilian |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Flanagan JM, Frohlich DM, Howard TA, Schultz WH, Driscoll C, Nagasubramanian R, Mortier NA, Kimble AC, Aygun B, Adams RJ, Helms RW, Ware RE, Genetic predictors for stroke in children with sickle cell anemia., Blood , 117(24), 6681-4, 2011 PubMed
- Belisário AR, Sales RR, Toledo NE, Muniz MB, Velloso-Rodrigues C, Silva CM, Viana MB, Reticulocyte count is the most important predictor of acute cerebral ischemia and high-risk transcranial Doppler in a newborn cohort of 395 children with sickle cell anemia., Ann. Hematol. , 95(11), 1869-80, 2016 PubMed
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-10 18:34:03 | The IthaGenes Curation Team | Created |
2 | 2018-08-13 18:18:28 | The IthaGenes Curation Team | Reviewed. Mutation comment, Ethnic origin, and Reference added. |