IthaID: 2647



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs2249358 HGVS Name: NG_011485.1:g.37594G>A

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTCAGACTCCATGTTTCAAAATCTA [A/G] ATGGAAGGTAAGAAGGAAGCAAGGA (Strand: +)

Comments: SNP associated with priapism in the Cooperative Study of Sickle Cell Disease (CSSCD) (148 cases; 529 controls) [PMID: 15638863]. The association was not replicated in an independent sample of sickle cell patients acquired from outpatient clinics at Duke University Medical Center, the University of North Carolina Chapel Hill and Emory University (n=199) [PMID: 17408468].

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Priapism [HP:0200023] [OMIM:176620]

Location

Chromosome: 13
Locus: NG_011485.1
Locus Location: 37594
Size: 1 bp
Located at: KL
Specific Location: Intron 1

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Nolan VG, Baldwin C, Ma Q, Wyszynski DF, Amirault Y, Farrell JJ, Bisbee A, Embury SH, Farrer LA, Steinberg MH, Association of single nucleotide polymorphisms in klotho with priapism in sickle cell anaemia., Br. J. Haematol. , 128(2), 266-72, 2005 PubMed
  2. Elliott L, Ashley-Koch AE, De Castro L, Jonassaint J, Price J, Ataga KI, Levesque MC, Brice Weinberg J, Eckman JR, Orringer EP, Vance JM, Telen MJ, Genetic polymorphisms associated with priapism in sickle cell disease., Br. J. Haematol. , 137(3), 262-7, 2007 PubMed
Created on 2016-05-10 17:02:31, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.