IthaID: 2646

Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs8141971 HGVS Name: NG_011884.2:g.77702T>C

Context nucleotide sequence:
tgatttcaatgagaggttagtaaaa [A/G] ataaagatgtaattttctcatccca (Strand: +)

Also known as:

Comments: SNP associated with focal segmental glomerulosclerosis in African Americans (56 cases; 1759 controls).

External Links


Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Focal segmental glomerulosclerosis [HP:0000097]


Chromosome: 22
Locus: NG_011884.2
Locus Location: 77702
Size: 1 bp
Located at: MYH9
Specific Location: Intron 12

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Genovese G, Tonna SJ, Knob AU, Appel GB, Katz A, Bernhardy AJ, Needham AW, Lazarus R, Pollak MR, A risk allele for focal segmental glomerulosclerosis in African Americans is located within a region containing APOL1 and MYH9., Kidney Int. , 78(7), 698-704, 2010 PubMed
Created on 2016-05-10 16:42:47, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.