IthaID: 264

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 137-139 (-TGGCTA) Val-Ala-Asn to Asp	HGVS Name:	HBB:c.413_418delTGGCTA
Hb Name:	Hb Stara Zagora	Protein Info:	β 137(H15) - 139(H17) Val-Ala-Asn->0 AND inserted Asp

Context nucleotide sequence:
GCCTATCAGAAAGTGGTGGCTGGTG [-/TGGCTA] ATGCCCTGGCCCACAAGTATCACTA (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	dbSNP
LOVD

Phenotype

Hemoglobinopathy Group:	Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup:	β-thalassaemia, β-chain variant
Allele Phenotype:	Thalassaemia dominant Dominant
Stability:	Unstable
Oxygen Affinity:	N/A
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	71987
Size:	6 bp
Located at:	β
Specific Location:	Exon 3

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	Insertion/Deletion of codons (Protein Structure)
Ethnic Origin:	Bulgarian
Molecular mechanism:	N/A
Inheritance:	Dominant
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Petkov GH, Simjanovska L, Tchakarova P, Efremov GD, Hb Stara Zagora: a new hyper-unstable hemoglobin causing severe hemolytic anemia., Hemoglobin, 29(4), 249-56, 2005 PubMed
Efremov GD, Dominantly Inherited beta-Thalassemia., Hemoglobin , 31(2), 193-207, 2007 PubMed

Created on 2010-06-16 16:13:15, Last reviewed on 2013-10-15 17:00:14 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:15	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.