IthaID: 263



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 134-137 (-12, +6 bp) Val-Ala-Gly-Val to Gly-Arg HGVS Name: HBB:c.404_413delinsGCAG
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
GTGCAGGCTGCCTATCAGAAAGTGG [GCAG/TGGCT] GGCTAATGCCCTGGCCCACAAGTAT (Strand: -)

Comments: Heterozygous individual with moderate anemia, marked microcytosis and hypochromia and large Heinz bodies.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71978
Size: 12 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Portuguese
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Oner R, Oner C, Wilson JB, Tamagnini GP, Ribeiro LM, Huisman TH, Dominant beta-thalassaemia trait in a Portuguese family is caused by a deletion of (G)TGGCTGGTGT(G) and an insertion of (G)GCAG(G) in codons 134, 135, 136 and 137 of the beta-globin gene., British journal of haematology, 79(2), 306-10, 1991 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2023-08-09 09:59:05 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.