IthaID: 2618



Names and Sequences

Functionality: Disease modifying mutation Pathogenicity: N/A
Common Name: rs1560909 HGVS Name: NG_009245.1:g.346101A>G

Context nucleotide sequence:
TTGTGACTTGTGCAGATTGTAGATT [A/G] TAGAATGTAGATTTACCAACAATTT (Strand: +)

Also known as:

Comments: SNP associated with leg ulcers in the Cooperative Study of Sickle Cell Disease (CSSCD) (243 cases;516 controls).

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Leg ulcers [OMIM:150590]

Location

Chromosome: 4
Locus: NG_009245.1
Locus Location: 346101
Size: 1 bp
Located at: BMPR1B
Specific Location: Intron 3

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Nolan VG, Adewoye A, Baldwin C, Wang L, Ma Q, Wyszynski DF, Farrell JJ, Sebastiani P, Farrer LA, Steinberg MH, Sickle cell leg ulcers: associations with haemolysis and SNPs in Klotho, TEK and genes of the TGF-beta/BMP pathway., Br. J. Haematol. , 133(5), 570-8, 2006 PubMed
Created on 2016-05-10 11:43:36, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.