IthaID: 2616
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs17022863 | HGVS Name: | NG_009245.1:g.265607A>G |
We follow the
HGVS sequence variant nomenclature
and
IUPAC standards.
Context nucleotide sequence:
GCATTTTAGTCACTGGATTACCTGG [A/G] TTTTTAAGTATTTTGCATCCCTGTG (Strand: +)
Comments: SNP associated with glomerular filtration rate in the Cooperative Study of Sickle Cell Disease (CSSCD) (n=1140).
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Abnormal GFR [HP:0012212] |
Location
| Chromosome: | 4 |
|---|---|
| Locus: | NG_009245.1 |
| Locus Location: | 265607 |
| Size: | 1 bp |
| Located at: | BMPR1B |
| Specific Location: | Intron 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | African American |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Nolan VG, Ma Q, Cohen HT, Adewoye A, Rybicki AC, Baldwin C, Mahabir RN, Homan EP, Wyszynski DF, Fabry ME, Nagel RL, Farrer LA, Steinberg MH, Estimated glomerular filtration rate in sickle cell anemia is associated with polymorphisms of bone morphogenetic protein receptor 1B., Am. J. Hematol. , 82(3), 179-84, 2007 PubMed
Created on 2016-05-10 11:06:24,
Last reviewed on (Show full history)
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.