IthaID: 2607
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | rs7526590 | HGVS Name: | NG_027757.1:g.155106T>A |
Context nucleotide sequence:
GCCAGCCAAACTAGATATTTCATAA [A/T] TACAGATGCAAATTCAACACCCGTC (Strand: +)
Also known as:
Comments: SNP associated with priapism in individuals with sickle cell disease (SCD) acquired from outpatient clinics at the Duke University Medical Center, the University of North Carolina Chapel Hill and the Emory University (n=199). SNP associated with risk of pulmonary hypertension in individuals with SCD acquired from outpatient clinics at the Duke University Medical Center and the University of North Carolina Chapel Hill (n=581).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | N/A |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: |
Priapism [HP:0200023] [OMIM:176620] Pulmonary arterial hypertension [HP:0002092] [OMIM:265400] |
Location
| Chromosome: | 1 |
|---|---|
| Locus: | NG_027757.1 |
| Locus Location: | 155106 |
| Size: | 1 bp |
| Located at: | TGFBR3 |
| Specific Location: | Intron 5 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | N/A |
| Ethnic Origin: | N/A |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Elliott L, Ashley-Koch AE, De Castro L, Jonassaint J, Price J, Ataga KI, Levesque MC, Brice Weinberg J, Eckman JR, Orringer EP, Vance JM, Telen MJ, Genetic polymorphisms associated with priapism in sickle cell disease., Br. J. Haematol. , 137(3), 262-7, 2007 PubMed
- Ashley-Koch AE, Elliott L, Kail ME, De Castro LM, Jonassaint J, Jackson TL, Price J, Ataga KI, Levesque MC, Weinberg JB, Orringer EP, Collins A, Vance JM, Telen MJ, Identification of genetic polymorphisms associated with risk for pulmonary hypertension in sickle cell disease., Blood , 111(12), 5721-6, 2008 PubMed
Created on 2016-05-09 18:07:06,
Last reviewed on 2016-05-23 11:44:47 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2016-05-09 18:07:06 | The IthaGenes Curation Team | Created |
| 2 | 2016-05-16 10:46:02 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2016-05-23 11:44:47 | The IthaGenes Curation Team | Reviewed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07