IthaID: 2606



Names and Sequences

Functionality: Disease modifying mutation
Common Name: rs284157 HGVS Name: NG_027757.1:g.104640G>A

Context nucleotide sequence:
ATCTGTTCCCAAATGCTTTGTCTGC [A/G] TTCTGTCGAGTTTTGGAGCTGGCCC (Strand: -)

Comments: SNP associated with osteonecrosis in the Cooperative Study of Sickle Cell Disease (CSSCD) (442 cases; 455 controls). Associated with acute chest syndrome in individuals with sickle cell disease.

External Links

Location

Chromosome: 1
Locus: NG_027757.1
Locus Location: 104640
Size: 1 bp
Located at: TGFBR3
Specific Location: Intron 3

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):N/A
Associated Phenotypes: Acute chest syndrome
Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: African American
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Lanson Y, Reignoux J, Jobard P, Vandooren M, Rouleau P, Soret JY, [Osteogenic sarcoma of the kidney. Apropos of a case. Review of the literature]., J Urol Nephrol (Paris) , 84(10), 827-34, 1978 PubMed
Created on 2016-05-09 17:44:10, Last reviewed on 2019-08-09 14:36:35 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.