IthaID: 2585
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs211239 | HGVS Name: | NG_011485.1:g.10619A>G |
Context nucleotide sequence:
TTTAAAATTTTTTCTTGGACTTGAC [C/T] GTAACCTTCAAAAAACAATGTGTTC (Strand: -)
Also known as:
Comments: SNP associated with avascular necrosis/osteonecrosis in the Cooperative Study of Sickle Cell Disease (CSSCD) (442 cases; 455 controls) [PMID: 15784727]. The association was not replicated in an independent sample of sickle cell patients of West African or African Caribbean descent (39 cases; 205 controls) [PMID: 19093115]. SNP associated with priapism in the CSSCD (148 cases; 529 controls) [PMID: 15638863], but the association was not replicated in an independent sample of sickle cell patients acquired from outpatient clinics at the Duke University Medical Center, the University of North Carolina Chapel Hill and the Emory University (n=199) [PMID: 17408468].
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: |
Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805] Priapism [HP:0200023] [OMIM:176620] |
Location
Chromosome: | 13 |
---|---|
Locus: | NG_011485.1 |
Locus Location: | 10619 |
Size: | 1 bp |
Located at: | KL |
Specific Location: | Intron 1 |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | African American |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Sequence Viewer
Publications / Origin
- Baldwin C, Nolan VG, Wyszynski DF, Ma QL, Sebastiani P, Embury SH, Bisbee A, Farrell J, Farrer L, Steinberg MH, Association of klotho, bone morphogenic protein 6, and annexin A2 polymorphisms with sickle cell osteonecrosis., Blood , 106(1), 372-5, 2005 PubMed
- Nolan VG, Baldwin C, Ma Q, Wyszynski DF, Amirault Y, Farrell JJ, Bisbee A, Embury SH, Farrer LA, Steinberg MH, Association of single nucleotide polymorphisms in klotho with priapism in sickle cell anaemia., Br. J. Haematol. , 128(2), 266-72, 2005 PubMed
- Elliott L, Ashley-Koch AE, De Castro L, Jonassaint J, Price J, Ataga KI, Levesque MC, Brice Weinberg J, Eckman JR, Orringer EP, Vance JM, Telen MJ, Genetic polymorphisms associated with priapism in sickle cell disease., Br. J. Haematol. , 137(3), 262-7, 2007 PubMed
- Ulug P, Vasavda N, Awogbade M, Cunningham J, Menzel S, Thein SL, Association of sickle avascular necrosis with bone morphogenic protein 6., Ann. Hematol. , 88(8), 803-5, 2009 PubMed
- Lettre G, The search for genetic modifiers of disease severity in the β-hemoglobinopathies., Cold Spring Harb Perspect Med , 2(10), , 2012 PubMed
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2016-05-09 12:16:06 | The IthaGenes Curation Team | Created |
2 | 2016-05-16 10:44:07 | The IthaGenes Curation Team | Reviewed. |