IthaID: 2585

Names and Sequences

Functionality:	Disease modifying mutation	Pathogenicity:	N/A
Common Name:	rs211239	HGVS Name:	NG_011485.1:g.10619A>G

Context nucleotide sequence:
TTTAAAATTTTTTCTTGGACTTGAC [C/T] GTAACCTTCAAAAAACAATGTGTTC (Strand: -)

Also known as:

Comments: SNP associated with avascular necrosis/osteonecrosis in the Cooperative Study of Sickle Cell Disease (CSSCD) (442 cases; 455 controls) [PMID: 15784727]. The association was not replicated in an independent sample of sickle cell patients of West African or African Caribbean descent (39 cases; 205 controls) [PMID: 19093115]. SNP associated with priapism in the CSSCD (148 cases; 529 controls) [PMID: 15638863], but the association was not replicated in an independent sample of sickle cell patients acquired from outpatient clinics at the Duke University Medical Center, the University of North Carolina Chapel Hill and the Emory University (n=199) [PMID: 17408468].

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

dbSNP

Phenotype

Allele Phenotype (Cis):	N/A
Allele Phenotype (Trans):	N/A
Associated Phenotypes:	Osteonecrosis/Avascular necrosis [HP:0010885] [OMIM:608805] Priapism [HP:0200023] [OMIM:176620]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	13
Locus:	NG_011485.1
Locus Location:	10619
Size:	1 bp
Located at:	KL
Specific Location:	Intron 1

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	African American
Molecular mechanism:	N/A
Inheritance:	Quantitative trait
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Baldwin C, Nolan VG, Wyszynski DF, Ma QL, Sebastiani P, Embury SH, Bisbee A, Farrell J, Farrer L, Steinberg MH, Association of klotho, bone morphogenic protein 6, and annexin A2 polymorphisms with sickle cell osteonecrosis., Blood , 106(1), 372-5, 2005 PubMed
Nolan VG, Baldwin C, Ma Q, Wyszynski DF, Amirault Y, Farrell JJ, Bisbee A, Embury SH, Farrer LA, Steinberg MH, Association of single nucleotide polymorphisms in klotho with priapism in sickle cell anaemia., Br. J. Haematol. , 128(2), 266-72, 2005 PubMed
Elliott L, Ashley-Koch AE, De Castro L, Jonassaint J, Price J, Ataga KI, Levesque MC, Brice Weinberg J, Eckman JR, Orringer EP, Vance JM, Telen MJ, Genetic polymorphisms associated with priapism in sickle cell disease., Br. J. Haematol. , 137(3), 262-7, 2007 PubMed
Ulug P, Vasavda N, Awogbade M, Cunningham J, Menzel S, Thein SL, Association of sickle avascular necrosis with bone morphogenic protein 6., Ann. Hematol. , 88(8), 803-5, 2009 PubMed
Lettre G, The search for genetic modifiers of disease severity in the β-hemoglobinopathies., Cold Spring Harb Perspect Med , 2(10), , 2012 PubMed

Created on 2016-05-09 12:16:06, Last reviewed on 2016-05-16 10:44:07 (Show full history)

A/A	Date	Curator(s)	Comments
1	2016-05-09 12:16:06	The IthaGenes Curation Team	Created
2	2016-05-16 10:44:07	The IthaGenes Curation Team	Reviewed.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.