IthaID: 256

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Pathogenic / Likely Pathogenic
Common Name:	CD 127/128 -AGG [Glu-Ala>Pro]	HGVS Name:	HBB:c.383_385delAGG
Hb Name:	Hb Gunma	Protein Info:	β 127(H5) - 128(H6) Gln-Ala->0 AND inserted Pro

Context nucleotide sequence:
GGCAAAGAATTCACCCCACCAGTGC [-/AGG] CTGCCTATCAGAAAGTGGTGGCTGG (Strand: -)

Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	ClinVar
dbSNP	OMIM
LOVD

Phenotype

Hemoglobinopathy Group:	Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup:	β-thalassaemia, β-chain variant
Allele Phenotype:	Thalassaemia dominant Dominant
Stability:	Unstable
Oxygen Affinity:	N/A
Associated Phenotypes:	Haemolytic anaemia [HP:0001878] Ineffective erythropoiesis [HP:0010972]

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	11
Locus:	NG_000007.3
Locus Location:	71957
Size:	3 bp
Located at:	β
Specific Location:	Exon 3

Other details

Type of Mutation:	Point-Mutation(Deletion)
Effect on Gene/Protein Function:	N/A
Ethnic Origin:	Japanese
Molecular mechanism:	Altered α1β1 interface
Inheritance:	Dominant
DNA Sequence Determined:	No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

Hattori Y, Yamane A, Yamashiro Y, Matsuno Y, Yamamoto K, Yamamoto K, Ohba Y, Miyaji T, Characterization of beta-thalassemia mutations among the Japanese., Hemoglobin, 13(7), 657-70, 1989 PubMed
Fucharoen S, Fucharoen G, Fukumaki Y, Nakayama Y, Hattori Y, Yamamoto K, Ohba Y, Three-base deletion in exon 3 of the beta-globin gene produced a novel variant (beta gunma) with a thalassemia-like phenotype., Blood, 76(9), 1894-6, 1990 PubMed
Ohba Y, Hattori Y, Harano T, Harano K, Fukumaki Y, Ideguchi H, beta-thalassemia mutations in Japanese and Koreans., Hemoglobin, 21(2), 191-200, 1997 PubMed

Created on 2010-06-16 16:13:15, Last reviewed on 2014-04-30 09:27:38 (Show full history)

A/A	Date	Curator(s)	Comments
1	2010-06-16 16:13:15	The IthaGenes Curation Team	Created
2	2013-10-15 17:00:14	The IthaGenes Curation Team	Reviewed.
3	2014-04-30 09:27:38	The IthaGenes Curation Team	Reviewed. Added ClinVar link and reference.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.