IthaID: 2529



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 50 +GGAGCC HGVS Name: HBA1:c.151_152insGGAGCC
Hb Name: Hb Bakersfield Protein Info: α1 50(CE8) His->0 AND Arg-Ser-His- inserted between 49(CE7) and 51(CE9)

Context nucleotide sequence:
CTACTTCCCGCACTTCGACCTGAGC [-/GGAGCC] ACGGCTCTGCCCAGGTTAAGGGCCA (Strand: +)

Comments: The Hb Bakersfield mutation is an in-frame insertion in the α1-globin gene, encoding a stable high oxygen affinity Hb variant that may lead to erythrocytosis and macrocytosis.

External Links

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37847
Size: 6 bp
Located at: α1
Specific Location: Exon 2

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: Increased Oxygen Affinity
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Jurassian
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Brunner-Agten S, von Känel T, Röthlisberger B, Broquet C, Huber AR, Hb Bakersfield (HBA1: c.151_152insGGAGCC): The Insertion of Arg-His Between Codons 49 and 50 of the α1-Globin Chain Leads to Increased Oxygen Affinity., Hemoglobin , 41(1), 1-5, 2017 PubMed
Created on 2014-10-09 12:05:39, Last reviewed on 2017-06-14 12:48:25 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.