IthaID: 2527
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 114 (+CC) | HGVS Name: | HBA2:c.344_345dup |
| Hb Name: | N/A | Protein Info: | α2 115(+CC); modified C-terminal sequence: (114)Pro-Pro-Pro-Ser-Ser-Pro-Leu-Arg-Cys-Thr-Pro-Pro-Trp-Thr-Ser-Ser-Trp-Leu-Leu-(133)COOH |
Context nucleotide sequence:
GCTGGTGACCCTGGCCGCCCACCTC [-/CC] CCGCCGAGTTCACCCCTGCGGTGCA (Strand: +)
Also known as:
Comments: The mutation causes a frameshift that results in a premature stop codon at amino acid 134. Sequencing results revealed a CC insertion within a repeat of four cytosines. This insertion probably gives rise to a dominant alpha-thalassemic mutation considering the probable absence of protein expression and the very low hematologic parameters of the heterozygous child. Patient and his father presented with severe microcytosis and hypochromia and elevated erythrocytes values.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | α-thalassaemia |
| Allele Phenotype: | α⁺ Dominant |
| Associated Phenotypes: | Haemolytic anaemia [HP:0001878] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 34378 |
| Size: | 2 bp |
| Located at: | α2 |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Insertion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Greek |
| Molecular mechanism: | N/A |
| Inheritance: | Dominant |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Saller E, Dutly F, Frischknecht H, Two novel α2 gene mutations causing altered amino acid sequences produce a mild (Hb Kinshasa, HBA2: c.428A > T) and severe (HBA2: c.342-345insCC) α-thalassemia phenotype., Hemoglobin , 39(2), 144-6, 2015 PubMed
Created on 2014-10-09 11:31:45,
Last reviewed on 2023-08-09 11:00:39 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2014-10-09 11:31:45 | The IthaGenes Curation Team | Created |
| 2 | 2017-10-02 11:38:05 | The IthaGenes Curation Team | Reviewed. Publication added. |
| 3 | 2020-04-30 23:42:06 | The IthaGenes Curation Team | Reviewed. HGVS name, Comment, Chromosome and locus location corrected. |
| 4 | 2020-05-05 08:21:21 | The IthaGenes Curation Team | Reviewed. Common name corrected. |
| 5 | 2020-05-13 11:55:45 | The IthaGenes Curation Team | Reviewed. Protein name corrected. |
| 6 | 2020-05-13 11:57:54 | The IthaGenes Curation Team | Reviewed. Allele phenotype added. |
| 7 | 2020-12-02 12:13:41 | The IthaGenes Curation Team | Reviewed. Comment edited. |
| 8 | 2023-08-09 11:00:39 | The IthaGenes Curation Team | Reviewed. Hemoglobinopathy type corrected |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07