IthaID: 2527



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 114 +CC HGVS Name: HBA2:c.343_344insCC
Hb Name: N/A Protein Info: α2 114(+CC); modified C-terminal sequence: (114)Pro-Pro-Pro-Ser-Ser-Pro-Leu-Arg-Cys-Thr-Pro-Pro-Trp-Thr-Ser-Ser-Trp-Leu-Leu-(133)COOH

Context nucleotide sequence:
GCTGGTGACCCTGGCCGCCCACCTC [-/CC] CCGCCGAGTTCACCCCTGCGGTGCA (Strand: +)

Comments: This insertion probably gives rise to a dominant alpha-thalassemic mutation considering the probable absence of protein expression and the very low hematologic parameters of the heterozygous child.

External Links

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34377
Size: 2 bp
Located at: α2
Specific Location: Exon 3

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-thalassaemia, α-chain variant
Allele Phenotype:Dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Greek
Inheritance: Dominant
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Saller E, Dutly F, Frischknecht H, Two novel α2 gene mutations causing altered amino acid sequences produce a mild (Hb Kinshasa, HBA2: c.428A > T) and severe (HBA2: c.342-345insCC) α-thalassemia phenotype., Hemoglobin , 39(2), 144-6, 2015 PubMed
Created on 2014-10-09 11:31:45, Last reviewed on 2017-10-02 11:38:05 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.