IthaID: 2520
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | CD 147 TGA>TTA | HGVS Name: | HBD:c.443G>T |
| Hb Name: | N/A | Protein Info: | δ 147 Stop>Leu |
Context nucleotide sequence:
AATGCCCTGGCTCACAAGTACCATT [G/T] AGATCCTGGACTGTTTCCTGATAAC (Strand: -)
Also known as:
Comments: The mutation results in an elongation of the transcript with 15 extra amino acids before reaching the new stop codon (TAG).
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
No available links
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | δ-thalassaemia, δ-chain variant |
| Allele Phenotype: | δ0 |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 64651 |
| Size: | 1 bp |
| Located at: | δ |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Oman |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Hassan SM, Harteveld CL, Bakker E, Giordano PC, Known and New δ-Globin Gene Mutations and Other Factors Influencing Hb A2 Measurement in the Omani Population., Hemoglobin , 2014 PubMed
- Alkindi S, AlZadjali S, Daar S, Ambusaidi R, Gravell D, Al Haddabi H, Krishnamoorthy R, Pathare A, First report of the spectrum of δ-globin gene mutations in Omani subjects - identification of novel mutations., Int J Lab Hematol , 2014 PubMed
Created on 2014-07-15 10:10:21,
Last reviewed on 2014-08-22 09:38:40 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2014-07-15 10:10:21 | The IthaGenes Curation Team | Created |
| 2 | 2014-07-15 10:20:54 | The IthaGenes Curation Team | Reviewed. Allele phenotype corrected. |
| 3 | 2014-08-22 09:38:40 | The IthaGenes Curation Team | Reviewed. New publication added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07