IthaID: 2520



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 147 TGA>TTA HGVS Name: HBD:c.443G>T
Hb Name: N/A Protein Info: δ 147 Stop>Leu

Context nucleotide sequence:
AATGCCCTGGCTCACAAGTACCATT [G/T] AGATCCTGGACTGTTTCCTGATAAC (Strand: -)

Comments: The mutation results in an elongation of the transcript with 15 extra amino acids before reaching the new stop codon (TAG).

External Links

No available links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 64651
Size: 1 bp
Located at: δ
Specific Location: Exon 3

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: δ-thalassaemia, δ-chain variant
Allele Phenotype:δ0
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Oman
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Hassan SM, Harteveld CL, Bakker E, Giordano PC, Known and New δ-Globin Gene Mutations and Other Factors Influencing Hb A2 Measurement in the Omani Population., Hemoglobin , 2014 PubMed
  2. Alkindi S, AlZadjali S, Daar S, Ambusaidi R, Gravell D, Al Haddabi H, Krishnamoorthy R, Pathare A, First report of the spectrum of δ-globin gene mutations in Omani subjects - identification of novel mutations., Int J Lab Hematol , 2014 PubMed
Created on 2014-07-15 10:10:21, Last reviewed on 2014-08-22 09:38:40 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.