IthaID: 252
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 126-131 (-17 bp) | HGVS Name: | HBB:c.380_396delTGCAGGCTGCCTATCAG |
| Hb Name: | Hb Westdale | Protein Info: | β 126 - 131 (-TGCAGGCTGCCTATCAG); modified C-terminal sequence: (126)Glu-Ser-Gly-Gly-Trp-Cys-(132)Gly-COOH |
Context nucleotide sequence:
TTTGGCAAAGAATTCACCCCACCAG [-/TGCAGGCTGCCTATCAG] AAAGTGGTGGCTGGTGTGGCTAATG (Strand: -)
Also known as:
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia and Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia, β-chain variant |
| Allele Phenotype: | β0 |
| Stability: | N/A |
| Oxygen Affinity: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 71954 |
| Size: | 17 bp |
| Located at: | β |
| Specific Location: | Exon 3 |
Other details
| Type of Mutation: | Point-Mutation(Deletion) |
|---|---|
| Effect on Gene/Protein Function: | Frameshift (Translation) |
| Ethnic Origin: | Trinidad, Pakistan, Indian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Frequencies
Publications / Origin
- Waye JS, Eng B, Francombe WH, Chui DH, Novel seventeen basepair deletion in exon 3 of the beta-globin gene., Human mutation, 6(3), 252-3, 1995 PubMed
- Ahmed S, Petrou M, Saleem M, Molecular genetics of beta-thalassaemia in Pakistan: a basis for prenatal diagnosis., British journal of haematology, 94(3), 476-82, 1996 PubMed
- Dehury S, Meher S, Patel S, Das K, Jana A, Bhattacharya S, Sahoo S, Sarkar B, Mohanty PK, Compound Heterozygote of Hb S (HBB: c.20A>T)/Hb Westdale (HBB: c.380_396delTGCAGGCTGCCTATCAG): Report of Four Cases from Odisha State, India., Hemoglobin, 43(2), 132-136, 2019 PubMed
- Tripathi P, Agarwal S, Gupta A, Mandal K, Biallelic rare 17 bp deletion mutation (HBB:c.380_396 del TGCAGGCTGCCTATCAG) in a transfusion depended form of thalassemia., Ann. Hematol., 2020 PubMed
Created on 2010-06-16 16:13:15,
Last reviewed on 2022-07-13 10:42:58 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2010-06-16 16:13:15 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-15 17:28:32 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2014-04-08 15:05:41 | The IthaGenes Curation Team | Reviewed. |
| 4 | 2014-04-08 15:07:23 | The IthaGenes Curation Team | Reviewed. |
| 5 | 2020-09-02 10:10:40 | The IthaGenes Curation Team | Reviewed. HGVS name, Chromoseme and Locus location correctes. References added. |
| 6 | 2020-09-02 10:11:41 | The IthaGenes Curation Team | Reviewed. HGVS name, Chromoseme and Locus location correctes. References added. |
| 7 | 2022-07-13 10:42:58 | The IthaGenes Curation Team | Reviewed. Allele Phenotype added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07