IthaID: 252



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 126-131 (-17 bp) HGVS Name: HBB:c.380_396delTGCAGGCTGCCTATCAG
Hb Name: Hb Westdale Protein Info: β 126 - 131 (-TGCAGGCTGCCTATCAG); modified C-terminal sequence: (126)Glu-Ser-Gly-Gly-Trp-Cys-(132)Gly-COOH

Context nucleotide sequence:
TTTGGCAAAGAATTCACCCCACCAG [-/TGCAGGCTGCCTATCAG] AAAGTGGTGGCTGGTGTGGCTAATG (Strand: -)

Also known as:

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71954
Size: 17 bp
Located at: β
Specific Location: Exon 3

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Trinidad, Pakistan, Indian
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Frequencies

Publications / Origin

  1. Waye JS, Eng B, Francombe WH, Chui DH, Novel seventeen basepair deletion in exon 3 of the beta-globin gene., Human mutation, 6(3), 252-3, 1995 PubMed
  2. Ahmed S, Petrou M, Saleem M, Molecular genetics of beta-thalassaemia in Pakistan: a basis for prenatal diagnosis., British journal of haematology, 94(3), 476-82, 1996 PubMed
  3. Dehury S, Meher S, Patel S, Das K, Jana A, Bhattacharya S, Sahoo S, Sarkar B, Mohanty PK, Compound Heterozygote of Hb S (HBB: c.20A>T)/Hb Westdale (HBB: c.380_396delTGCAGGCTGCCTATCAG): Report of Four Cases from Odisha State, India., Hemoglobin, 43(2), 132-136, 2019 PubMed
  4. Tripathi P, Agarwal S, Gupta A, Mandal K, Biallelic rare 17 bp deletion mutation (HBB:c.380_396 del TGCAGGCTGCCTATCAG) in a transfusion depended form of thalassemia., Ann. Hematol., 2020 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2020-09-02 10:11:41 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.