IthaID: 2519

Names and Sequences

Functionality:	Globin gene causative mutation
Common Name:	CD 127 AAG>TAG	HGVS Name:	HBA2:c.382A>T
Hb Name:	N/A	Protein Info:	α2 127(H10) Lys>Glu

Context nucleotide sequence:
CCCTGCGGTGCACGCCTCCCTGGAC [A/T] AGTTCCTGGCTTCTGTGAGCACCGT (Strand: +)

External Links

No available links

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	34416
Size:	1 bp
Located at:	α2
Specific Location:	Exon 3

Phenotype

Hemoglobinopathy Group:	Thalassaemia
Hemoglobinopathy Subgroup:	α-thalassaemia
Allele Phenotype:	N/A
Associated Phenotypes:	N/A

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Nonsense codon (Translation)
Ethnic Origin:	Iranian
Inheritance:	Recessive
DNA Sequence Determined:	Yes
Detection Methods:	Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Hamid M, Bokharaei Merci H, Galehdari H, Saberi AH, Kaikhaei B, Mohammadi-Anaei M, Ahmadzadeh A, Shariati G, A Novel Alpha-thalassemia Nonsense Mutation in HBA2: C.382 A > T globin Gene., Arch Iran Med , 17(7), 475-6, 2014 PubMed

Created on 2014-07-15 09:44:47, Last reviewed on (Show full history)

A/A	Date	Curator(s)	Comments
1	2014-07-15 09:44:47	The IthaGenes Curation Team	Created

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.