IthaID: 2510



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 27 GAG>GAC [Glu>Asp] HGVS Name: HBA1:c.84G>C
Hb Name: Hb Hekinan Protein Info: α1 27(B8) Glu>Asp

Context nucleotide sequence:
CGCACGCTGGCGAGTATGGTGCGGA [C/G] GCCCTGGAGAGGTGAGGCTCCCTCC (Strand: +)

External Links

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37663
Size: 1 bp
Located at: α1
Specific Location: Exon 1

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: African, Chinese, Japanese, Thai
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Harano T, Harano K, Imai N, Ueda S, Seki M, An electrophoretically silent hemoglobin variant, Hb Hekinan [alpha 27(B8)Glu----Asp] found in a Japanese., Hemoglobin , 12(1), 61-5, 1988 PubMed
  2. Zhao W, Wilson JB, Webber BB, Kutlar A, Tamagnini GP, Kuam B, Huisman TH, Hb Hekinan observed in three Chinese from Macau; identification of the GAG----GAT mutation in the alpha 1-globin gene., Hemoglobin , 14(6), 627-35, 1990 PubMed
  3. Molchanova TP, Pobedimskaya DD, Huisman TH, The differences in quantities of alpha 2- and alpha 1-globin gene variants in heterozygotes., Br. J. Haematol. , 88(2), 300-6, 1994 PubMed
  4. Ngiwsara L, Srisomsap C, Winichagoon P, Fucharoen S, Svasti J, Two cases of compound heterozygosity for Hb Hekinan [alpha27(B8)Glu-->Asp (alpha1)] and alpha-thalassemia in Thailand., Hemoglobin , 28(2), 145-50, 2004 PubMed
  5. Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009 PubMed
Created on 2014-06-05 12:47:02, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.