IthaID: 2508

Names and Sequences

Functionality:	Globin gene causative mutation	Pathogenicity:	Benign / Likely Benign
Common Name:	CD 120 GCG>GAG [Ala>Glu]	HGVS Name:	HBA1:c.362C>A
Hb Name:	Hb J-Meerut	Protein Info:	α1 120(H3) Ala>Glu

Context nucleotide sequence:
CACCTCCCCGCCGAGTTCACCCCTG [A/C] GGTGCACGCCTCCCTGGACAAGTTC (Strand: +)

Also known as: Hb J-Birmingham

We follow the HGVS sequence variant nomenclature and IUPAC standards.

External Links

HbVar	dbSNP
OMIM	ClinVar

Phenotype

Hemoglobinopathy Group:	Structural Haemoglobinopathy
Hemoglobinopathy Subgroup:	α-chain variant
Allele Phenotype:	N/A
Stability:	N/A
Oxygen Affinity:	N/A
Associated Phenotypes:	N/A

IthaPhen

Heterozygous records (preview in IthaPhen)

Location

Chromosome:	16
Locus:	NG_000006.1
Locus Location:	38207
Size:	1 bp
Located at:	α1
Specific Location:	Exon 3

Other details

Type of Mutation:	Point-Mutation(Substitution)
Effect on Gene/Protein Function:	Missense codons (Protein Structure)
Ethnic Origin:	Indian, Japanese, Turkish
Molecular mechanism:	N/A
Inheritance:	Recessive
DNA Sequence Determined:	Yes

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

Blackwell RQ, Wong HB, Wang CL, Weng MI, Liu CS, Hemoglobin J Meerut: alpha120 Ala leads to Glu., Biochim. Biophys. Acta , 351(1), 7-12, 1974 PubMed
Harano T, Harano K, Imai K, Yunoki H, Yagi H, Nagashima K, Kuroume T, Hb J-Meerut [alpha 120(H3)Ala----Glu] found in a Japanese family., Hemoglobin , 13(2), 169-75, 1989 PubMed
Molchanova TP, Pobedimskaya DD, Huisman TH, The differences in quantities of alpha 2- and alpha 1-globin gene variants in heterozygotes., Br. J. Haematol. , 88(2), 300-6, 1994 PubMed
Yalçin A, Avcu F, Beyan C, Gürgey A, Ural AU, A case of HB J-Meerut (or Hb J-Birmingham) [alpha 120(H3)Ala-->Glu]., Hemoglobin , 18(6), 433-5, 1994 PubMed
Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009 PubMed

Created on 2014-06-05 12:23:26, Last reviewed on 2024-02-13 12:34:32 (Show full history)

A/A	Date	Curator(s)	Comments
1	2014-06-05 12:23:26	The IthaGenes Curation Team	Created
2	2024-02-13 12:34:32	The IthaGenes Curation Team	Reviewed. ClinVar corrected.

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.