IthaID: 2506
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Pathogenic / Likely Pathogenic |
|---|---|---|---|
| Common Name: | CD 87 CAC>TAC [His>Tyr] | HGVS Name: | HBA1:c.262C>T |
| Hb Name: | Hb M-Iwate | Protein Info: | α1 87(F8) His>Tyr |
Context nucleotide sequence:
CGCGCTGTCCGCCCTGAGCGACCTG [A/C/G/T] ACGCGCACAAGCTTCGGGTGGACCC (Strand: +)
Also known as: Hb M-Kankakee , Hb M-Oldenburg , Hb M-Sendai
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Structural Haemoglobinopathy |
|---|---|
| Hemoglobinopathy Subgroup: | α-chain variant |
| Allele Phenotype: | Methemoglobinaemia |
| Stability: | N/A |
| Oxygen Affinity: | Decreased Oxygen Affinity |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NG_000006.1 |
| Locus Location: | 37958 |
| Size: | 1 bp |
| Located at: | α1 |
| Specific Location: | Exon 2 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Missense codons (Protein Structure) |
| Ethnic Origin: | Japanese, Irish, German, Turkish, Romanian, Scottish, Caucasian, African-American |
| Molecular mechanism: | Altered heme pocket |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Konigsberg W, Lehmann H, The amino acid substitution in hemoglobin M-Iwate., Biochim. Biophys. Acta , 107(2), 266-9, 1965 PubMed
- Sjöquist J, Heterogeneity of heavy (gamma) chain preparations from human gamma G-immunoglobulins., Nature , 210(5041), 1182-3, 1966 PubMed
- Jones RT, Coleman RD, Heller P, The structural abnormality of hemoglobin M Kankakee., J. Biol. Chem. , 241(9), 2137-43, 1966 PubMed
- Ozsoylu S, Congenital methemoglobinemia due to hemoglobin M., Acta Haematol. , 47(4), 225-32, 1972 PubMed
- Trittelvitz E, Gersonde K, Winterhalter KH, Electron-spin resonance of nitrosyl haemoglobins: normal alpha and beta chains and mutants Hb M Iwate and Hb Zürich., Eur. J. Biochem. , 51(1), 33-42, 1975 PubMed
- Horst J, Assum G, Griese EU, Eigel A, Hampl W, Kohne E, Hemoglobin M Iwate is caused by a C----T transition in codon 87 of the human alpha 1-globin gene., Hum. Genet. , 75(1), 53-5, 1987 PubMed
- Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009 PubMed
Created on 2014-06-05 11:57:56,
Last reviewed on 2015-12-03 14:44:03 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2014-06-05 11:57:56 | The IthaGenes Curation Team | Created |
| 2 | 2014-06-05 12:00:21 | The IthaGenes Curation Team | Reviewed. ClinVar link added. |
| 3 | 2015-12-03 14:44:03 | The IthaGenes Curation Team | Reviewed. Phenotype updated |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07