IthaID: 2505



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 78 AAC>AAG [Asn>Lys] HGVS Name: HBA1:c.237C>G
Hb Name: Hb Stanleyville-II Protein Info: α1 78(EF7) Asn>Lys

Context nucleotide sequence:
TGGCGCACGTGGACGACATGCCCAA [C/G] GCGCTGTCCGCCCTGAGCGACCTGC (Strand: +)

External Links

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 37933
Size: 1 bp
Located at: α1
Specific Location: Exon 2

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: African
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Van Ros G, Beale D, Lehmann H, Haemoglobin Stanleyville II (alpha asparagine replaced by lysine)., Br Med J , 4(5623), 92-3, 1968 PubMed
  2. North ML, Darbre PD, Lehmann H, Juif JG, Haemoglobin Stanleyville II (alpha75 [EF 7] Asn yeilds Lys) found in France., Acta Haematol. , 53(1), 56-9, 1975 PubMed
  3. Rhoda MD, Martin J, Blouquit Y, Garel MC, Edelstein SJ, Rosa J, Sickle cell hemoglobin fiber formation strongly inhibited by the Stanleyville II mutation (alpha 78 Asn leads to Lys)., Biochem. Biophys. Res. Commun. , 111(1), 8-13, 1983 PubMed
  4. Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009 PubMed
Created on 2014-06-05 11:40:42, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.