IthaID: 2500



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 47 GAC>CAC [Asp>His] HGVS Name: HBA1:c.142G>C
Hb Name: Hb Hasharon Protein Info: α1 47(CE5) Asp>His

Context nucleotide sequence:
CACCAAGACCTACTTCCCGCACTTC [A/C/G/T] ACCTGAGCCACGGCTCTGCCCAGGT (Strand: +)

Also known as: Hb L-Ferrara , Hb Michigan-I , Hb Michigan-II , Hb Sealy , Hb Sinai

External Links

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 34034
Size: 1 bp
Located at: α1
Specific Location: Exon 2

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: α-chain variant
Allele Phenotype:N/A
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Ashkenazi Jews
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

HPLC

Disclaimer: The HPLC images are provided as an information resource only. Bio-Rad Laboratories, Inc and the ITHANET Portal disclaim responsibility and have no liability if this information is used for diagnostic or treatment purposes. D-10™ and VARIANT™ are registered trademarks of Bio-Rad Laboratories, Inc. and used with permission. Redistribution and use of the above material is allowed only with permission by Bio-Rad Laboratories, Inc. To access HPLC images and reports for different variants, use the IthaChrom tool.
ID Hb Variant Gene Instrument Method Area (%) Ret Time (min) Comments
273Hb Hasharonα1D-10Dual Kit Program21.54.53heterozygote[PDF]
425Hb Hasharonα1D-10Dual Kit Program25.44.56Heterozygote with alpha 3.7. Clinically normal in heterozygote. [PDF]
429Hb Hasharonα1D-10Dual Kit Program29.14.56Heterozygote with alpha 3.7. Clinically normal in heterozygote.[PDF]
276Hb Hasharonα1VARIANT IIDual Kit Program19.24.19heterozygote[PDF]
428Hb Hasharonα1VARIANT IIDual Kit Program25.94.205Heterozygote with alpha 3.7. Clinically normal in heterozygote.[PDF]
432Hb Hasharonα1VARIANT IIDual Kit Program274.207Heterozygote with alpha 3.7. Clinically normal in heterozygote.[PDF]
274Hb Hasharonα1VARIANTβ-thal Short Program19.54.74heterozygote[PDF]
426Hb Hasharonα1VARIANTβ-thal Short Program25.74.74Heterozygote with alpha 3.7. Clinically normal in heterozygote.[PDF]
430Hb Hasharonα1VARIANTβ-thal Short Program27.94.74Heterozygote with alpha 3.7. Clinically normal in heterozygote.[PDF]
275Hb Hasharonα1VARIANT IIβ-thal Short Program204.82heterozygote[PDF]
427Hb Hasharonα1VARIANT IIβ-thal Short Program27.14.82Heterozygote with alpha 3.7. Clinically normal in heterozygote.[PDF]

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Halbrecht I, Isaacs WA, Lehmann H, Ben-Porat F, Hemoglobin hasharon (alpha-47 aspartic acid--histidine)., Isr. J. Med. Sci. , 3(6), 827-31, 1967 PubMed
  2. Ostertag W, Smith EW, Hb Sinai, a new alpha chain mutant alpha his 47., Humangenetik , 6(4), 377-9, 1968 PubMed
  3. Schneider RG, Ueda S, Alperin JB, Brimhall B, Jones RT, Hemoglobin sealy (alpha 2-47His-beta 2): a new variant in a Jewish family., Am. J. Hum. Genet. , 20(2), 151-6, 1968 PubMed
  4. Molchanova TP, Pobedimskaya DD, Huisman TH, The differences in quantities of alpha 2- and alpha 1-globin gene variants in heterozygotes., Br. J. Haematol. , 88(2), 300-6, 1994 PubMed
  5. Moradkhani K, Préhu C, Old J, Henderson S, Balamitsa V, Luo HY, Poon MC, Chui DH, Wajcman H, Patrinos GP, Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants., Ann. Hematol. , 88(6), 535-43, 2009 PubMed
Created on 2014-06-05 10:43:47, Last reviewed on 2017-04-11 16:13:38 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.