IthaID: 2496



Names and Sequences

Functionality: Neutral polymorphism Pathogenicity: Benign / Likely Benign
Common Name: TTS +48 G>A HGVS Name: HBB:c.*182G>A

Context nucleotide sequence:
TTTTACTAAAAAGGGAATGTG [G/A] GAGGTCAGTGCATTTAAAACA (Strand: -)

Also known as: CAP +1656 G>A

External Links

Phenotype

Allele Phenotype:Neutral
Associated Phenotypes: N/A

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 72200
Size: 1 bp
Located at: β
Specific Location: 3'UTR

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Other 3'UTR site (mRNA Processing)
Ethnic Origin: Italian
Molecular mechanism: N/A
Inheritance: Quantitative trait
DNA Sequence Determined: Yes

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Vinciguerra M, Passarello C, Leto F, Cassarà F, Cannata M, Maggio A, Giambona A, Identification of three new nucleotide substitutions in the β-globin gene: laboratoristic approach and impact on genetic counselling for beta-thalassaemia., Eur. J. Haematol. , 92(5), 444-9, 2014 PubMed
Created on 2014-06-05 09:23:45, Last reviewed on 2021-02-12 15:27:33 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.