IthaID: 2496
Names and Sequences
| Functionality: | Globin gene causative mutation | Pathogenicity: | Benign / Likely Benign |
|---|---|---|---|
| Common Name: | TTS +48 G>A | HGVS Name: | HBB:c.*182G>A |
| Hb Name: | N/A | Protein Info: | N/A |
Context nucleotide sequence:
TTTTACTAAAAAGGGAATGTG [G/A] GAGGTCAGTGCATTTAAAACA (Strand: -)
Also known as: CAP +1656 G>A
We follow the HGVS sequence variant nomenclature and IUPAC standards.
Phenotype
| Hemoglobinopathy Group: | Thalassaemia |
|---|---|
| Hemoglobinopathy Subgroup: | β-thalassaemia |
| Allele Phenotype: | N/A |
| Associated Phenotypes: | N/A |
Location
| Chromosome: | 11 |
|---|---|
| Locus: | NG_000007.3 |
| Locus Location: | 72200 |
| Size: | 1 bp |
| Located at: | β |
| Specific Location: | 3'UTR |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Other 3'UTR site (mRNA Processing) |
| Ethnic Origin: | Italian |
| Molecular mechanism: | N/A |
| Inheritance: | Quantitative trait |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Vinciguerra M, Passarello C, Leto F, Cassarà F, Cannata M, Maggio A, Giambona A, Identification of three new nucleotide substitutions in the β-globin gene: laboratoristic approach and impact on genetic counselling for beta-thalassaemia., Eur. J. Haematol. , 92(5), 444-9, 2014 PubMed
Created on 2014-06-05 09:23:45,
Last reviewed on 2022-10-21 09:38:43 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2014-06-05 09:23:45 | The IthaGenes Curation Team | Created |
| 2 | 2021-02-12 15:18:57 | The IthaGenes Curation Team | Reviewed. HGVS and common name corrected. |
| 3 | 2021-02-12 15:20:55 | The IthaGenes Curation Team | Reviewed. Synonym added. |
| 4 | 2021-02-12 15:27:33 | The IthaGenes Curation Team | Reviewed. Chromosome location added. |
| 5 | 2022-10-21 09:38:43 | The IthaGenes Curation Team | Reviewed. Functionality changed. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07