IthaID: 2482



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 137 -GTG [-Val] HGVS Name: HBD:c.412_414delGTG
Hb Name: Hb Lincoln Park Protein Info: δ 137(H15) Val->0

Context nucleotide sequence:
TGCCTATCAGAAGGTGGTGGCTGGT [-/GTG] GCTAATGCCCTGGCTCACAAGTACC (Strand: -)

Also known as: Hb Anti-Lepore Lincoln Park

Comments: A δβ fusion (anti-Lepore) variant with an amino acid deletion in the δ chain-derived segment. Hb Lincoln Park is identical to HbP-Nilotic but is associated with reticulocytosis. It contains a deletion of

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 64620
Size: 3 bp
Located at: δ
Specific Location: Exon 3

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: δ-chain variant
Allele Phenotype:δβ fusion
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]

Other details

Type of Mutation: Point-Mutation(Deletion)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Mexican
Inheritance: Recessive
DNA Sequence Determined: No
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Honig GR, Shamsuddin M, Mason RG, Vida LN, Hemoglobin Lincoln Park: a betadelta fusion (anti-Lepore) variant with an amino acid deletion in the delta chain-derived segment., Proc. Natl. Acad. Sci. U.S.A. , 75(3), 1475-9, 1978 PubMed
  2. Honig GR, Mason RG, Tremaine LM, Vida LN, Unbalanced globin chain synthesis by Hb Lincoln Park (anti-Lepore) reticulocytes., Am. J. Hematol. , 5(4), 335-40, 1978 PubMed
Created on 2014-06-04 13:38:35, Last reviewed on 2018-04-17 09:20:37 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.