IthaID: 248



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 125 (+CCA) HGVS Name: HBB:c.376_378dupCCA
Hb Name: N/A Protein Info: N/A
Also known as:

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Context nucleotide sequence:
TTGGCAAAGAATTCACCCCACCA [-/CCA] GTGCAGGCTGCCTATCAGAAAGT (Strand: -)

Comments: Found in a heterozygous state in a young Armenian girl with a dominant type of beta-thal trait, characterized by a rather severe anemia (Hb 7-9 g/dl), hypochromia, target cells, basophilic stippling, and splenomegaly. Parents were unavailable for study.

External Links

Phenotype

Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: β-thalassaemia, β-chain variant
Allele Phenotype:Dominant
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71950
Size: 3 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Insertion/Deletion of codons (Protein Structure)
Ethnic Origin: Armenian
Molecular mechanism: N/A
Inheritance: Dominant
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Cürük MA, Molchanova TP, Postnikov YuV , Pobedimskaya DD, Liang R, Baysal E, Kolodey S, Smetanina NS, Tokarev YuN , Rumyantsev AG, Beta-thalassemia alleles and unstable hemoglobin types among Russian pediatric patients., American journal of hematology, 46(4), 329-32, 1994 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-12 14:28:03 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.