IthaID: 2475
Names and Sequences
Functionality: | Globin gene causative mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | 21.9 kb deletion with 29 bp insertion | HGVS Name: | NG_000006.1:g.[14373_36299del21927; insGGGAAGGGTGGGTGGGAATAACAGCTTTT] |
Hb Name: | N/A | Protein Info: | deletion of 21927 nts from the ζ2 gene to α2 gene AND nts GGGAAGGGTGGGTGGGAATAACAGCTTTT inserted between nts 655 and 656 of ζ2 |
Also known as: Qinzhou type deletion
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Hemoglobinopathy Group: | Thalassaemia |
---|---|
Hemoglobinopathy Subgroup: | α-thalassaemia |
Allele Phenotype: | α⁺ |
Associated Phenotypes: | N/A |
Location
Chromosome: | 16 |
---|---|
Locus: | NG_000006.1 |
Locus Location: | 14373 |
Size: | 21.927 kb |
Deletion involves: | ζ, α2 |
Other details
Type of Mutation: | Deletion |
---|---|
Ethnic Origin: | Chinese |
Molecular mechanism: | N/A |
Inheritance: | Recessive |
DNA Breakpoint Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Long J, Yan S, Lao K, Pang W, Ye X, Sun L, The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia., Blood Cells Mol. Dis. , 52(4), 225-9, 2014 PubMed
- Long J, Pang W, Sun L, Lao K, Weng X, Ye X, Wu S, Song C, Wei X, Yan S, Diagnosis of a Family with the Novel -α(21.9) Thalassemia Deletion., Hemoglobin , 39(6), 419-22, 2015 PubMed
Created on 2014-06-03 17:23:29,
Last reviewed on 2016-08-26 10:59:35 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2014-06-03 17:23:29 | The IthaGenes Curation Team | Created |
2 | 2014-06-03 17:25:16 | The IthaGenes Curation Team | Reviewed. |
3 | 2015-12-07 12:35:04 | The IthaGenes Curation Team | Reviewed. Mutation type updated. |
4 | 2016-08-26 10:59:35 | The IthaGenes Curation Team | Reviewed. Reference added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07