IthaID: 2475



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: 21.9 kb deletion with 29 bp insertion HGVS Name: NG_000006.1:g.[14373_36299del21927; insGGGAAGGGTGGGTGGGAATAACAGCTTTT]
Hb Name: N/A Protein Info: deletion of 21927 nts from the ζ2 gene to α2 gene AND nts GGGAAGGGTGGGTGGGAATAACAGCTTTT inserted between nts 655 and 656 of ζ2

Also known as: Qinzhou type deletion

External Links

Location

Chromosome: 16
Locus: NG_000006.1
Locus Location: 14373
Size: 21.927 kb
Deletion involves: ζ, α2

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: α-thalassaemia
Allele Phenotype:α⁺
Associated Phenotypes: N/A

Other details

Type of Mutation: Deletion
Ethnic Origin: Chinese
Inheritance: Recessive
DNA Breakpoint Determined: Yes
Detection Methods: MLPA

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Long J, Yan S, Lao K, Pang W, Ye X, Sun L, The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia., Blood Cells Mol. Dis. , 52(4), 225-9, 2014 PubMed
  2. Long J, Pang W, Sun L, Lao K, Weng X, Ye X, Wu S, Song C, Wei X, Yan S, Diagnosis of a Family with the Novel -α(21.9) Thalassemia Deletion., Hemoglobin , 39(6), 419-22, 2015 PubMed
Created on 2014-06-03 17:23:29, Last reviewed on 2016-08-26 10:59:35 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.