IthaID: 240



Names and Sequences

Functionality: Globin gene causative mutation Pathogenicity: Pathogenic / Likely Pathogenic
Common Name: CD 116 (+TGAT) HGVS Name: HBB:c.349_350insTGAT
Hb Name: N/A Protein Info: β 116(+TGAT); modified C-terminal sequence: (116)Leu-Ile-Ser-Leu-Trp-Gln-Arg-Ile-His-Pro-Thr- Ser-Ala-Gly-Cys-Leu-Ser-Glu-Ser-Gly-Gly- Trp-Cys-Gly-(140)COOH

Context nucleotide sequence:
AACGTGCTGGTCTGTGTGCTGGCCC [-/TGAT] ATCACTTTGGCAAAGAATTCACCCC (Strand: -)

Also known as:

Comments: The insertion of TGAT within codon 116 (CAT>CTGATAT) generates a frameshift and a premature termination codon between codons 138 and 139. Found among members of a family who are Tamil refugees residing in Switzerland. Found in combination with HBB:c.364G>C (Hb D-Punjab) in a yound child presenting with microcytic anaemia. Found in a heterozygous state in the father.

We follow the HGVS sequence variant nomenclature and IUPAC standards.

Phenotype

Hemoglobinopathy Group: Thalassaemia
Hemoglobinopathy Subgroup: β-thalassaemia
Allele Phenotype:β0
Associated Phenotypes: Haemolytic anaemia [HP:0001878]
Ineffective erythropoiesis [HP:0010972]

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: 71924
Size: 4 bp
Located at: β
Specific Location: Exon 3

Other details

Type of Mutation: Point-Mutation(Insertion)
Effect on Gene/Protein Function: Frameshift (Translation)
Ethnic Origin: Sri Lankan
Molecular mechanism: N/A
Inheritance: Recessive
DNA Sequence Determined: No

In silico pathogenicity prediction

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Frischknecht H, Kiewitz R, Schmugge M, A 4 base pair TGAT insertion at codon 116 of the beta globin gene causes beta0-thalassemia., Haematologica, 90(0), ECR20, 2005 PubMed
Created on 2010-06-16 16:13:15, Last reviewed on 2019-11-14 09:15:02 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.