IthaID: 2378



Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 6 GAG>CAG [Glu>Gln] HGVS Name: HBD:c.19G>C
Hb Name: Hb A2-Ramallah Protein Info: δ 6(A3) Glu>Gln

Context nucleotide sequence:
AGACACCATGGTGCATCTGACTCCT [C/G] AGGAGAAGACTGCTGTCAATGCCCT (Strand: -)

External Links

Location

Chromosome: 11
Locus: NG_000007.3
Locus Location: N/A
Size: 1 bp
Located at: δ
Specific Location: Exon 1

Phenotype

Hemoglobinopathy Group: Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: δ-chain variant
Allele Phenotype:N/A
Stability: N/A
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Nigerian
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Phylipsen M, Harteveld CL, de Metz M, Gallivan MV, Arkesteijn SG, Luo HY, Chui DH, Giordano PC, New and known β-thalassemia determinants masked by known and new δ gene defects [Hb A(2)-Ramallah or δ6(A3)Glu→Gln, GAG>CAG]., Hemoglobin , 34(5), 445-50, 2010 PubMed
Created on 2014-05-26 10:17:11, Last reviewed on (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.