IthaID: 2346



Names and Sequences

Functionality: Disease modifying mutation
Common Name: -154 C>T HGVS Name: NG_013087.1:g.4910C>T

Context nucleotide sequence:
GAAGTTTGTGCCCCAGAAACAGTGC [C/T] CCCCCGCCGCCTTGCCTTGCTTTGC (Strand: -)

Comments: Found as a compound heterozygote with p.A298P in a Thai patient with severe, transfusion-dependent hemolytic anemia characterized by abnormally low levels of the red cell enzyme pyruvate kinase, a known cause of chronic nonspherocytic hemolytic anemias (CNSHA). Persistent expression of fetal haemoglobin (Hb F) and expression of large quantities of embryonic globins in post-natal life. The change is predicted to alter the binding of transcription factors P53, Pax5 and ETF [PMID: 24443441]. Found as a compound heterozygote with p.Q217X in Thai patients homozygous or heterozygous for Hb E. Patients showed high levels of Hb F and lower MCV and MCH values compared to healthy controls [PMID: 27282573].

External Links

Location

Chromosome: 19
Locus: NG_013087.1
Locus Location: 4910
Size: 1 bp
Located at: KLF1
Specific Location: Promoter 0

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):Increased expression for ε
Increased expression for Aγ or Gγ
Associated Phenotypes: Hb F levels [HP:0011904] [OMIM:141749]

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: N/A
Ethnic Origin: Thai
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Viprakasit V, Ekwattanakit S, Riolueang S, Chalaow N, Fisher C, Lower K, Kanno H, Tachavanich K, Bejrachandra S, Saipin J, Juntharaniyom M, Sanpakit K, Tanphaichitr VS, Songdej D, Babbs C, Gibbons RJ, Philipsen S, Higgs DR, Mutations in Kruppel-like factor 1 cause transfusion-dependent hemolytic anemia and persistence of embryonic globin gene expression., Blood , 2014 PubMed
  2. Tepakhan W, Yamsri S, Sanchaisuriya K, Fucharoen G, Xu X, Fucharoen S, Nine known and five novel mutations in the erythroid transcription factor KLF1 gene and phenotypic expression of fetal hemoglobin in hemoglobin E disorder., Blood Cells Mol. Dis. , 59(0), 85-91, 2016 PubMed
Created on 2014-03-20 15:21:05, Last reviewed on 2019-05-07 13:23:10 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.