IthaID: 2293



Names and Sequences

Functionality: Disease modifying mutation
Common Name: CD 326 (GAG>AAG) HGVS Name: NG_013087.1:g.7207G>T

Context nucleotide sequence:
TGGAGATTCGCGCGCTCGGACGAGC [G/T] GACCCGCCACTACCGGAAACACACG (Strand: -)

Comments: Protein Change: L326R. Cause bordeline HbA2

External Links

Location

Chromosome: 19
Locus: NG_013087.1
Locus Location: 7207
Size: 1 bp
Located at: KLF1
Specific Location: Exon 3

Phenotype

Allele Phenotype (Cis):N/A
Allele Phenotype (Trans):Increased expression for δ
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Nonsense codon (Translation)
Ethnic Origin: Sardinians
Inheritance: Quantitative trait
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Perseu L, Satta S, Moi P, Demartis FR, Manunza L, Sollaino MC, Barella S, Cao A, Galanello R, KLF1 gene mutations cause borderline HbA(2)., Blood , 118(16), 4454-8, 2011 PubMed
Created on 2013-12-20 11:33:54, Last reviewed on 2014-03-20 10:58:39 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.