IthaID: 2292

Names and Sequences

Functionality: Globin gene causative mutation
Common Name: CD 19 AAC>AAA [Asn>Lys] HGVS Name: HBD:c.60C>A
Hb Name: Hb Famagusta Protein Info: δ 19 Asn>Lys

Context nucleotide sequence:
ctgactcctgaggagaagactgctgtcaatgccctgtggggcaaagtgaa [C/A] gtggatgcagttggtggtgaggccctgggcagattactggtggtctaccc (Strand: -)

External Links

No available links


Chromosome: 11
Locus: NG_000007.3
Locus Location: 63242
Size: 1 bp
Located at: δ
Specific Location: Exon 1


Hemoglobinopathy Group: Thalassaemia and Structural Haemoglobinopathy
Hemoglobinopathy Subgroup: δ-thalassaemia, δ-chain variant
Allele Phenotype:δ+
Stability: Unstable
Oxygen Affinity: N/A
Associated Phenotypes: N/A

Other details

Type of Mutation: Point-Mutation(Substitution)
Effect on Gene/Protein Function: Missense codons (Protein Structure)
Ethnic Origin: Cypriot
Inheritance: Recessive
DNA Sequence Determined: Yes
Detection Methods: Direct DNA sequencing

Sequence Viewer

Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI. Therefore, IthaGenes has no responsibility over any temporary unavailability of the service. In such a case, please Refresh the page or retry at a later stage. Otherwise, use this external link.

Publications / Origin

  1. Lederer CW, Pavlou E, Makariou C, Hadjilambi G, Andreou N, Hadjigavriel M, Kolnagou A, Sitarou M, Christou S, Kleanthous M, Hb Famagusta-analysis of a novel δ-globin chain variant [HBD:c.60C>A] in four families with diverse globin genotypes., Ann. Hematol. , 2014 PubMed
Created on 2013-11-19 17:08:06, Last reviewed on 2014-01-28 09:12:32 (Show full history)

Disclaimer: The information on this website is provided as an information resource only and must not to be used as a substitute for professional diagnosis and treatment. The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment, diagnosis or any other information, services or products that an individual obtains through this website.

Please publish modules in offcanvas position.