IthaID: 2289
Names and Sequences
| Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
|---|---|---|---|
| Common Name: | IVS I-146 (G>A) | HGVS Name: | NT_010393.16:g.31479430G>A |
Context nucleotide sequence:
GGGGAGGAAGTGGGTTGGGGGAAATACCCAGTGAGGAGGGAAACAGATAT [G/A] TAAATTCTACCCTTTTCTCTACCCAGGCAGATGGCTCTTCTTAAGGCCAATAAGGATCTC (Strand: +)
Also known as: 12391 (G>A), c.100-27G, rs4296276
Comments: This SNP in intron 1 of AHSP affects the Oct-1 transcription factor binding site, which is required for optimal AHSP promoter activity. The A allele is predicted to impair Oct-1 binding and thus reduce ASHP mRNA expression. (PMID 16186125)
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
| Allele Phenotype (Cis): | Decreased expression for AHSP |
|---|---|
| Allele Phenotype (Trans): | N/A |
| Associated Phenotypes: | Anaemia [HP:0001903] |
Location
| Chromosome: | 16 |
|---|---|
| Locus: | NT_010393.16 |
| Locus Location: | 31479430 |
| Size: | 1 bp |
| Located at: | AHSP |
| Specific Location: | Intron 1 |
Other details
| Type of Mutation: | Point-Mutation(Substitution) |
|---|---|
| Effect on Gene/Protein Function: | Promoter (Transcription) |
| Ethnic Origin: | Afro-Caribbean, Indian, Brasilian, Mediterranean, Papua New Guinean, Melanesian |
| Molecular mechanism: | N/A |
| Inheritance: | Recessive |
| DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Gallagher PG, Liem RI, Wong E, Weiss MJ, Bodine DM, GATA-1 and Oct-1 are required for expression of the human alpha-hemoglobin-stabilizing protein gene., J. Biol. Chem. , 280(47), 39016-23, 2005 PubMed
Created on 2013-10-16 17:04:31,
Last reviewed on 2019-07-04 12:01:21 (Show full history)
| A/A | Date | Curator(s) | Comments |
|---|---|---|---|
| 1 | 2013-10-16 17:04:31 | The IthaGenes Curation Team | Created |
| 2 | 2013-10-17 10:35:32 | The IthaGenes Curation Team | Reviewed. |
| 3 | 2019-07-04 12:01:21 | The IthaGenes Curation Team | Reviewed. Phenotype added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-11-20 13:24:07